ID: 929874162_929874167

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 929874162 929874167
Species Human (GRCh38) Human (GRCh38)
Location 2:45782597-45782619 2:45782623-45782645
Sequence CCAGTGTTTCCAAGATAATGTAC TGTGTTTGACCCTCAGATTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 141} {0: 1, 1: 0, 2: 1, 3: 11, 4: 172}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!