ID: 929898037_929898046

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 929898037 929898046
Species Human (GRCh38) Human (GRCh38)
Location 2:45978443-45978465 2:45978495-45978517
Sequence CCTCTAATGTTGGCCTTCACCTA ACAGACTGGCTTAGAACCATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 76} {0: 1, 1: 0, 2: 3, 3: 8, 4: 141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!