ID: 929921254_929921258

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 929921254 929921258
Species Human (GRCh38) Human (GRCh38)
Location 2:46173114-46173136 2:46173130-46173152
Sequence CCCACCACCTGCTTTTGTGCAGC GTGCAGCCCTAGAATAAGAATGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 14, 3: 55, 4: 367} {0: 1, 1: 0, 2: 1, 3: 15, 4: 131}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!