ID: 929986228_929986231

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 929986228 929986231
Species Human (GRCh38) Human (GRCh38)
Location 2:46735529-46735551 2:46735572-46735594
Sequence CCCAGAGCACTCTAATTATTTCA TTGCCTTCTCTGCTTGATTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 212} {0: 1, 1: 0, 2: 1, 3: 33, 4: 335}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!