ID: 930384410_930384412

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 930384410 930384412
Species Human (GRCh38) Human (GRCh38)
Location 2:50675534-50675556 2:50675549-50675571
Sequence CCAGTGGAGTGATGATAAACTAG TAAACTAGAAGATTCCTTTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 92} {0: 1, 1: 0, 2: 2, 3: 19, 4: 298}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!