ID: 930402890_930402898

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 930402890 930402898
Species Human (GRCh38) Human (GRCh38)
Location 2:50913253-50913275 2:50913294-50913316
Sequence CCTATGGCTAACTTGTGAACTAG AATCACAATTGGACAATTTAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 77} {0: 1, 1: 0, 2: 0, 3: 17, 4: 250}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!