ID: 930480440_930480444

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 930480440 930480444
Species Human (GRCh38) Human (GRCh38)
Location 2:51942374-51942396 2:51942399-51942421
Sequence CCCAACAGGGTTAACACTTAAAT GGAACTTAAAGACGAAAAAAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 19, 4: 381}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!