ID: 930660158_930660171

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 930660158 930660171
Species Human (GRCh38) Human (GRCh38)
Location 2:54045246-54045268 2:54045274-54045296
Sequence CCCTCCACGATCCCCTTAAAAAC CCTACAATTCCTTGGGGAGATGG
Strand - +
Off-target summary {0: 2, 1: 28, 2: 60, 3: 68, 4: 172} {0: 1, 1: 0, 2: 4, 3: 35, 4: 178}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!