ID: 930709937_930709939

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 930709937 930709939
Species Human (GRCh38) Human (GRCh38)
Location 2:54541208-54541230 2:54541241-54541263
Sequence CCCATTATATGTCTCTACTATGA TTTTATGCCTAGAACTGCAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 218} {0: 1, 1: 0, 2: 1, 3: 13, 4: 145}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!