ID: 930722967_930722977

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 930722967 930722977
Species Human (GRCh38) Human (GRCh38)
Location 2:54655631-54655653 2:54655679-54655701
Sequence CCGTCTTGCTGTCCCTCTCCTGA CACGACAAAACAGCTTTGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 65, 4: 622} {0: 1, 1: 0, 2: 0, 3: 4, 4: 76}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!