ID: 930755573_930755588

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 930755573 930755588
Species Human (GRCh38) Human (GRCh38)
Location 2:54968818-54968840 2:54968850-54968872
Sequence CCCTCCCCATCTCAGGCATCCCG CTCTCCCAGGGGCATGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 247} {0: 1, 1: 0, 2: 5, 3: 38, 4: 400}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!