ID: 930858750_930858753

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 930858750 930858753
Species Human (GRCh38) Human (GRCh38)
Location 2:56047207-56047229 2:56047228-56047250
Sequence CCTAGTTGTACTTACCTTATAGT GTTCAGCAGCACCTTGCTGGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 6, 4: 118} {0: 1, 1: 0, 2: 11, 3: 50, 4: 209}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!