ID: 930872855_930872866

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 930872855 930872866
Species Human (GRCh38) Human (GRCh38)
Location 2:56185029-56185051 2:56185051-56185073
Sequence CCTACCCCCAGTCCCCAGCCCCT TGTGTAACTTTTCCAAACTTCGG
Strand - +
Off-target summary {0: 1, 1: 10, 2: 35, 3: 347, 4: 2129} {0: 1, 1: 0, 2: 1, 3: 23, 4: 256}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!