ID: 930878413_930878421

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 930878413 930878421
Species Human (GRCh38) Human (GRCh38)
Location 2:56245391-56245413 2:56245407-56245429
Sequence CCCTCCTCATGCCACATGGCCTC TGGCCTCTGCCAGGGGATGGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 30, 4: 337} {0: 2, 1: 10, 2: 30, 3: 117, 4: 683}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!