ID: 930887352_930887354

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 930887352 930887354
Species Human (GRCh38) Human (GRCh38)
Location 2:56341258-56341280 2:56341276-56341298
Sequence CCAGAGATCTTACTGGGGAAGTG AAGTGGTAATCAACAGTACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 50, 4: 295} {0: 1, 1: 0, 2: 0, 3: 6, 4: 116}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!