ID: 931010655_931010659

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 931010655 931010659
Species Human (GRCh38) Human (GRCh38)
Location 2:57908933-57908955 2:57908958-57908980
Sequence CCAATCAAAAGTAGCCAAAACCT GAAAATTATTAATATAATTAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 231} {0: 1, 1: 0, 2: 10, 3: 114, 4: 1138}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!