ID: 931018044_931018050

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 931018044 931018050
Species Human (GRCh38) Human (GRCh38)
Location 2:58008949-58008971 2:58008975-58008997
Sequence CCCACAGAGAAGGAGGAATGTGG ACTCACAGGGAGAAGGTAGAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 30, 4: 295} {0: 1, 1: 0, 2: 3, 3: 27, 4: 335}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!