ID: 931038980_931038985

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 931038980 931038985
Species Human (GRCh38) Human (GRCh38)
Location 2:58275750-58275772 2:58275792-58275814
Sequence CCGTCCACCACTGCTGTTTGCCG GACTTCCATCCGTCCAGATCCGG
Strand - +
Off-target summary {0: 62, 1: 126, 2: 64, 3: 58, 4: 189} {0: 1, 1: 31, 2: 70, 3: 106, 4: 131}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!