ID: 931118088_931118096

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 931118088 931118096
Species Human (GRCh38) Human (GRCh38)
Location 2:59186243-59186265 2:59186291-59186313
Sequence CCCCACGCTAGTAGTCAAAAGTG TGGTTCTCAAAGTGTGGTCCTGG
Strand - +
Off-target summary No data {0: 15, 1: 79, 2: 164, 3: 312, 4: 632}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!