|
Left Crispr |
Right Crispr |
Crispr ID |
931118088 |
931118096 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
2:59186243-59186265
|
2:59186291-59186313
|
Sequence |
CCCCACGCTAGTAGTCAAAAGTG |
TGGTTCTCAAAGTGTGGTCCTGG |
Strand |
- |
+ |
Off-target summary |
No data |
{0: 15, 1: 79, 2: 164, 3: 312, 4: 632} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|