ID: 931316417_931316425

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 931316417 931316425
Species Human (GRCh38) Human (GRCh38)
Location 2:61136795-61136817 2:61136844-61136866
Sequence CCCTGCACCTACTAAAAATAAAA GCCTGTAATCCCAGCTACTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 200, 3: 6309, 4: 88538} {0: 35616, 1: 158937, 2: 257753, 3: 440394, 4: 391946}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!