ID: 931325604_931325608

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 931325604 931325608
Species Human (GRCh38) Human (GRCh38)
Location 2:61218947-61218969 2:61218991-61219013
Sequence CCATTCCTTGGAAGAAAGTCACT GGAATTAAGCTCCACCTCCTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 33, 4: 673} {0: 1, 1: 5, 2: 7, 3: 30, 4: 196}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!