ID: 931341740_931341744

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 931341740 931341744
Species Human (GRCh38) Human (GRCh38)
Location 2:61408543-61408565 2:61408588-61408610
Sequence CCTACAATTCTTCTGATTAACAG AAAATCAGGTTTAAAGTAAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 168} {0: 1, 1: 1, 2: 1, 3: 36, 4: 372}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!