ID: 931355839_931355846

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 931355839 931355846
Species Human (GRCh38) Human (GRCh38)
Location 2:61537475-61537497 2:61537493-61537515
Sequence CCGCCGCCGCGCCCCACGCCGGC CCGGCCTCCTCCCGCCCGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 104, 4: 903} {0: 1, 1: 0, 2: 6, 3: 66, 4: 447}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!