ID: 931489296_931489301

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 931489296 931489301
Species Human (GRCh38) Human (GRCh38)
Location 2:62726324-62726346 2:62726339-62726361
Sequence CCAGTTCAACTCACCCAGTCTCC CAGTCTCCTGGAATCCTTGGAGG
Strand - +
Off-target summary {0: 1, 1: 6, 2: 26, 3: 76, 4: 375} {0: 1, 1: 0, 2: 2, 3: 24, 4: 308}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!