ID: 931495732_931495736

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 931495732 931495736
Species Human (GRCh38) Human (GRCh38)
Location 2:62804974-62804996 2:62805001-62805023
Sequence CCTGGAAAACTGTCTTCCATGAA GTCTCTGGTGCCAGAAAGATTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 35, 4: 365} {0: 1, 1: 19, 2: 254, 3: 1506, 4: 2073}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!