ID: 931547790_931547806

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 931547790 931547806
Species Human (GRCh38) Human (GRCh38)
Location 2:63408443-63408465 2:63408488-63408510
Sequence CCCCAAGCAGGCCATTCCTAACC GGGGGTGGCCAGAAGGAAGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 79, 4: 290} {0: 1, 1: 0, 2: 4, 3: 90, 4: 848}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!