ID: 931568330_931568334

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 931568330 931568334
Species Human (GRCh38) Human (GRCh38)
Location 2:63640377-63640399 2:63640402-63640424
Sequence CCAGCTATTCAGGTGGCAGTGGC GAGGATTGCTTAAGCCTGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 112, 3: 5835, 4: 102948} {0: 4, 1: 181, 2: 2791, 3: 10178, 4: 45174}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!