ID: 931614563_931614580

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 931614563 931614580
Species Human (GRCh38) Human (GRCh38)
Location 2:64143754-64143776 2:64143800-64143822
Sequence CCGCCACCCGCAGAGCTCCCCTC CCAGGCGCGGGGCTCGGAGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 43, 4: 400} {0: 1, 1: 0, 2: 1, 3: 15, 4: 247}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!