ID: 931614568_931614577

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 931614568 931614577
Species Human (GRCh38) Human (GRCh38)
Location 2:64143771-64143793 2:64143794-64143816
Sequence CCCCTCTCGCAGCCGGAGCGCGC GGCCAGCCAGGCGCGGGGCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 66} {0: 1, 1: 1, 2: 3, 3: 43, 4: 410}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!