ID: 931695778_931695784

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 931695778 931695784
Species Human (GRCh38) Human (GRCh38)
Location 2:64869540-64869562 2:64869556-64869578
Sequence CCACAAGCACATACCCCCAAGAC CCAAGACCAAATCAGAAGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 369} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!