ID: 931762447_931762456

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 931762447 931762456
Species Human (GRCh38) Human (GRCh38)
Location 2:65430654-65430676 2:65430675-65430697
Sequence CCCACACTCCCCTGCAAAGACGC GCGCGCGGGGCCTCCCTCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 127} {0: 1, 1: 0, 2: 0, 3: 18, 4: 110}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!