ID: 931869774_931869789

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 931869774 931869789
Species Human (GRCh38) Human (GRCh38)
Location 2:66445450-66445472 2:66445485-66445507
Sequence CCTGTCCCTCCGGGGCGCTGAAC GTCCTGGGGGCCGGGCAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 77} {0: 1, 1: 1, 2: 6, 3: 64, 4: 695}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!