ID: 932048203_932048208

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 932048203 932048208
Species Human (GRCh38) Human (GRCh38)
Location 2:68371358-68371380 2:68371408-68371430
Sequence CCAACAGTTAGAGAGATGATACC CTGGTTTACCTGCAGCTTTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 85} {0: 1, 1: 0, 2: 1, 3: 19, 4: 288}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!