ID: 932064321_932064324

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 932064321 932064324
Species Human (GRCh38) Human (GRCh38)
Location 2:68537126-68537148 2:68537170-68537192
Sequence CCACACTCCAGGTTGGGAGACAG AAAAAAAAAGAGAAATTATAAGG
Strand - +
Off-target summary {0: 2, 1: 9, 2: 421, 3: 4712, 4: 6865} {0: 1, 1: 5, 2: 132, 3: 1837, 4: 19762}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!