ID: 932085707_932085709

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 932085707 932085709
Species Human (GRCh38) Human (GRCh38)
Location 2:68756789-68756811 2:68756823-68756845
Sequence CCACTCAAAGGGGAAAACAAAGA AGTGCCTGATGAAGACCTGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 430} {0: 1, 1: 0, 2: 0, 3: 15, 4: 167}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!