ID: 932131228_932131234

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 932131228 932131234
Species Human (GRCh38) Human (GRCh38)
Location 2:69189240-69189262 2:69189272-69189294
Sequence CCAGAAGAGCCCAATGACAGCAG ATCAAGCATGCCCTGCAAGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 189} {0: 1, 1: 0, 2: 0, 3: 4, 4: 99}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!