ID: 932168273_932168282

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 932168273 932168282
Species Human (GRCh38) Human (GRCh38)
Location 2:69528608-69528630 2:69528650-69528672
Sequence CCACTGAGAGAAACTGAAAAGAG GAGGGTAAAAAGAAGGAAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 408} {0: 1, 1: 0, 2: 17, 3: 183, 4: 1484}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!