ID: 932195517_932195534

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 932195517 932195534
Species Human (GRCh38) Human (GRCh38)
Location 2:69779876-69779898 2:69779929-69779951
Sequence CCTTTGCTCAGGGTGTGTCCCAG CCAGGTAATAGGGGGTAAGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 236} {0: 1, 1: 0, 2: 1, 3: 8, 4: 106}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!