ID: 932214574_932214582

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 932214574 932214582
Species Human (GRCh38) Human (GRCh38)
Location 2:69958574-69958596 2:69958601-69958623
Sequence CCACTTACAGACTCTTTACCCTC CTTCTACCCAGCACGTGGCTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!