ID: 932306065_932306075

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 932306065 932306075
Species Human (GRCh38) Human (GRCh38)
Location 2:70705063-70705085 2:70705110-70705132
Sequence CCTGTAAAAGGGAAGAAGGAAGC CTGCCTGAGCCCTGAAATCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 44, 4: 347} {0: 1, 1: 0, 2: 2, 3: 32, 4: 312}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!