ID: 932312562_932312571

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 932312562 932312571
Species Human (GRCh38) Human (GRCh38)
Location 2:70755382-70755404 2:70755427-70755449
Sequence CCCTGACCACTCTGGCTAAAGCA GAGTTTATCTTCTGCATAATGGG
Strand - +
Off-target summary {0: 2, 1: 6, 2: 26, 3: 228, 4: 1718} {0: 1, 1: 0, 2: 2, 3: 23, 4: 268}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!