ID: 932313839_932313845

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 932313839 932313845
Species Human (GRCh38) Human (GRCh38)
Location 2:70767169-70767191 2:70767184-70767206
Sequence CCGGGGATGGCCTCCGCCCCGGC GCCCCGGCTGCAGAAAGGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 211} {0: 1, 1: 0, 2: 3, 3: 22, 4: 270}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!