ID: 932313849_932313858

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 932313849 932313858
Species Human (GRCh38) Human (GRCh38)
Location 2:70767187-70767209 2:70767239-70767261
Sequence CCGGCTGCAGAAAGGGAGGGGAG ACAGACTGGCAAGACCCCCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 469} {0: 1, 1: 0, 2: 1, 3: 11, 4: 114}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!