ID: 932314435_932314441

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 932314435 932314441
Species Human (GRCh38) Human (GRCh38)
Location 2:70770141-70770163 2:70770166-70770188
Sequence CCAGAGTTTGTGGGCCCTAACCA ACACTGCATGGCCTCCCAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 59} {0: 1, 1: 1, 2: 0, 3: 13, 4: 196}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!