ID: 932334439_932334440

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 932334439 932334440
Species Human (GRCh38) Human (GRCh38)
Location 2:70922013-70922035 2:70922032-70922054
Sequence CCAAGAAGCAGATGATGTCATTC ATTCCCATGTTACACGTGAAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 17, 3: 166, 4: 560} {0: 1, 1: 0, 2: 1, 3: 18, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!