ID: 932338551_932338560

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 932338551 932338560
Species Human (GRCh38) Human (GRCh38)
Location 2:70944588-70944610 2:70944614-70944636
Sequence CCATCCTCCAGCCCTTCAGACCT CCTTGCATCAAATTTGCCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 61, 4: 663} {0: 1, 1: 0, 2: 0, 3: 8, 4: 117}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!