ID: 932357521_932357535

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 932357521 932357535
Species Human (GRCh38) Human (GRCh38)
Location 2:71078492-71078514 2:71078532-71078554
Sequence CCTACACCTTTTCCTAGGGGGCT CTCCAAGCTCAGTGGACACTGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 17, 4: 95} {0: 2, 1: 0, 2: 0, 3: 13, 4: 172}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!