ID: 932409291_932409299

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 932409291 932409299
Species Human (GRCh38) Human (GRCh38)
Location 2:71535635-71535657 2:71535677-71535699
Sequence CCAGTGAGGAGAGGCTCACAAAC GAGCAGAGCTTCAGGGAGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 140} {0: 1, 1: 2, 2: 4, 3: 71, 4: 529}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!