ID: 932412141_932412147

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 932412141 932412147
Species Human (GRCh38) Human (GRCh38)
Location 2:71553789-71553811 2:71553811-71553833
Sequence CCCGTCTCTCCATTCCAGGGTGC CCACTACTACTACCTACCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 298} {0: 1, 1: 0, 2: 0, 3: 10, 4: 95}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!