ID: 932414437_932414439

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 932414437 932414439
Species Human (GRCh38) Human (GRCh38)
Location 2:71565122-71565144 2:71565161-71565183
Sequence CCAGGCTGGAGTGTAGTGGTGTG GCCTCCGCCTCACAAGTTCAAGG
Strand - +
Off-target summary {0: 836, 1: 24272, 2: 81479, 3: 175220, 4: 204942} {0: 1, 1: 0, 2: 63, 3: 939, 4: 7273}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!